Ingen header – what’s so ever!

AHHH…

Hej Bloggen! Fy vad dåligt, aja baja på mig. Jag har såååå freakin’ fuuullt upp nu att det är GALET. Jag har haft det så jääkla kul också ;) Har förra veckan gått balen och tagit STUDENTEN shalalalalal fy fan va jag e bra haha!!

Därför har jag inte hunnit blogga så där direkt. Men det kommer inlägg snart med bilder från bal och student. Ingen header har jag heller haha, vad är detta?! YAYA ;) Nu måste jag jobba vidare med Miss Summer Tylösand GAHHHHHH snart smäller det :D

TACATATATATATAAAAAAA

PUSS

N

 

1 kommentar

Goodnight lovers! And… Ps. Anmäl er till Miss Summer Tylösand 2012 :)

Hej alla kära!

När arbetsdagen slutar 21.45 orkar man knappt skriva två ord till, men det är så mycket fantastiskt kul som händer och jag vill ju så gärna berätta. På två dagar har över 3000 besökare besökt vår fanpage för Miss Summer Tylösand 2012, som ni hittar här: www.facebook.se/misssummertylosand, och vi har redan nu fått in fantastiska tjejer med oerhört fina värderingar som anmält sig till tävlingen i hopp om att få delta i finalen V. 28 på Hotel Tylösand/Solgården under dagarna 12-14 juli. För att anmäla sig går du in på: www.misstylosand.se. Går jättesnabbt och enkelt. Det verkar som alla vill vara med när de får höra vad vi håller på med, snacka om att vara på rätt plats vid rätt tidspunkt :) Har du inte redan bestämt dig så kom till Tylösand V.28!

Sleep tight, see you in the morning!

N

0 kommentarer

La la lala la la lala la Love.. Oh I mean, WORK…

Woopa…

Tjena snyggingar och blogg! Skulle slängt upp outfit nu men jag ligger efter i arbete och måste få det klart för annars kommer mitt hjärta bulta i 190 hela natten. Var inne på ett kort möte hos SODA igår, ser riktigt snyggt ut med alla mina Never Tell Your Tailor tröjor. Glöm inte att in och shoppa på SODA, de tar slut så jäkla snabbt och i sommar hoppas vi på att få se hela Solgården i Tylösand vara klädd på ********* med tröjorna ;) YES så är det, men kan ännu inte tala om vad det rör sig om.

Just nu skickar jag jobbmail och går igenom planering för min skola, då jag missade förra terminen pga Miss World. SAMTIDIGT bleker jag tänderna haha :D Att bleka tänderna är en gnutta obehagligt och har jag inte Sensodyn tandkräm kommer ilningarna på ett BUMS! Bleker tänderna gör jag hos Barbro Berg i Halmstad. Hon är helt fantatsisk och vet vad hon gör. Barbro var även en utav mina sponsorer under min tid i Miss World.

Här är bild utanför butiken SODA i Halmstad, igår, där tröjorna “Never Tell Your Tailor” finns :) Det är de vi ser i skylltfönstret! Under är bild på blekningsmedlet jag har till tänderna som kommer från Barbro Berg i Halmstad!

Nu ska jag käka, hörs lateroo!!

N

1 kommentar

I helgen gjorde jag…

Hard work work…

Tja Bloggen! Försökte blogga igår men då la bara hela servern ner så kunde inte blogga, så jag passade på att bara njuta av solen istället ;) I fredgas var jag på möte med min manager hos UnCutMe i Halmstad, kan inte säga vad vi har på G men snart så SPRICKER jag av att få berätta vad mitt nästa projekt är, så jag hoppas vi kommer lansera det ikväll eller i morgon :D

I lördags var vi hemma hos Linnea i hennes sommarstuga, jag, Linnea, Cathis och Frida. Vi hade grillmys och drack förfärligt massa gott vin haha. Sedan bänkade vi oss framför melodifestivalen med Italiensk glass från Möllegård. Det var en fantatsisk kväll som slutade med att Sverige, Loreen tog hem segern, vi stod och hoppade upp o ner och körde igång en riktig fest, Grattis Loreen och grattis Sverige! Måste bara säga FY FAN VAR BRA HON VAR! Och i löpet av kvällen fick vi lite nice killgäng på besök och vi festade till 05.30 på morgonen haha! Det var en rosa afton, rosa kläder, rosé vin, YES allt var rosa ;) Igår mös jag bara med familjen på stranden och firade mors dag. Vi åt god lunch och åt härlig grillmat på kvällen :)

 

 

 

0 kommentarer

Lägenhet med utsikt över havet i Båstad uthyres!

Skynda er…

Hej Bloggen! Det här är ett UNIKT tillfälle och erbjudande så skynda er!

LISTEN UP PEOPLE: Nybyggd fräsch lägenhet i centrum av Båstad uthyres under Tennisveckorna. Hyresperiod: 10/6 – 15/8 veckovis eller månadsvis. Lägenheten är 30 kvm. med utsikt över Båstad och havsvattnet samt stranden. Max 2 personer.

KONTAKTA Stephan Artursson på 0708-541250 för mer info. :)

N

 

0 kommentarer

Min Dag

Pughhhh…

Hej Bloggen! Vilken dag det har varit. Nu har vi ätit god mat och dricker mycket gott vin! Jag är mega trött nu efter en sån lång dag, hade först ett föredrag i skolan i morse, sedan hade jag lite jobbsamtal och har planerat nya projektmöten, efter var jag på möte i Falkenberg och sedan övningskörde jag hem.

Outfit bilderna idag blev kassa, de var förstora att göra i instagram och sedan orkade jag inte ta med systemkameran haha! Jag har en jättefin systemkamera så jag få börja fota outfit bilder med den igen då man kan ställa in ljuset snyggt.

Kläderna jag har på mig idag är: Jackan är från Tommy Hilfiger, pälsen kommer från märket HOLLIES Stockholm, T-shirten är från Never Tell My Tailor, den bruna Iphone hållaren kommer jag inte ihåg märket på men det är äkta skinn, jeansen kommer från Diesel, skorna är från GANT och den rosa resväskan är sponsrad av KENTS i Halmstad.

 

Nu sitter jag i mina nya sovshorts från FC kollektion, jag älskar dem och de är så fina med den lilla färg jag redan fått av solen. De köpte jag på fannycastelius.se!

I morgon bär det av till Danmark så jag ska snart sova, känns som jag slumrar ner i tangenterna snart.

Natti natii

N

0 kommentarer

“Arbetslösa ungdomar i Halmstad skapar oro”

Gott folk, det här är intressant!…

Hej Bloggen! Vilket väder det är idag, lyser som bara den och varmt är det :D Tog mig en tur ner till stranden och fick förvånansvärt ganska mycket färg i ansiktet!

Läste i Halmstad Lokaltidningen idag, där det står i en artikel ”Arbetslösa ungdomar i Halmstad skapar oro”. För många är detta något som visar på ett tecken för just “oro”, vilket syftet är meningen att det ska framstå som, men för mig väcker detta passion, att kunna göra gott för andra så de i sin tur kan föra vidare sin utveckling. Och med det här menar jag att jag ser en stor potential till arbetskraft.

Jag jobbar mycket med att engagera andra och skapa intresse, och istället för att se detta som något negativt kan vi se detta positivt eftersom det är en stor mängd arbetskraft som ”går lös” där ute i Halmstad, vilket vi kan engagera och dra nytta av! Som i sin tur lär ut de andra :)

Vad tycker ni?

Nu ska jag plugga vidare!

Kram kram!

N

3 kommentarer

24+ grader i skuggan och glad Valborg!

Så härligt!!

Hej Bloggen! Det är ganska så komiskt, när jag tänkte på en sak. Ni är många läsare men det är bara på få antal inlägg ni verkligen kommenterar, så jag får väl börja blogga lite mer om det ni ber om är intressant, om man ska uttrycka det lite så :) Det tycker jag är jätteroligt och jag har märkt att frågeställningar är populärt!

Fler outfit bilder ska det definitivt bli! :D

I lördags satt jag i juryn för Miss World Sweden 2012 och igår firade vi Valborg. Har haft min kärlek på besök och vi har bara myst massor tillsammans med familjen, ätit supergod mat och njutit av det fina vädret. Faktiskt har vi fått grymt mycket gjort :) OCH så invigde vi grillen ;) Som det smakade!! I veckan kom också mitt BLING BLING mobilskal jag hade beställt från iphonestugan.se + att jag har köpt nya skor till studenten från Bianco och igår kom min klänning som jag beställt från nelly.se vilket jag ska ha till studenten. Idag har jag också bara njutit av vädret för att vi har haft 24 grader, 24 GRADER I SKUGGAN kan ni fatta :D  Så jag har solat hela dagen i bikini och nu har vi ätit god grillad mat.

Nu ska jag njuta vidare av denna fantatsiskt underbara kväll tillsammans med min familj :)

N

0 kommentarer

Spännande paket från en spännande person :)

Älskar sånna här fina uppmuntringar :)

Hej Bloggen! Vi har sorg i familjen då en man som var mig mycket nära gått bort, det gör verkligen ont.

Igår fick jag ett paket som jag bara älskar att få sådana! Fick av bästa Karin Lundqvist :D Karin är proffisionell beachvolley spelare och var tidigare sponsrad av min far. Karin är verkligen en jättestor förebild för mig och hon har verkligen influrerat mitt intresse till att spela beach :) Karin skickade mig två toppar (haha älskar att få sådana!) så nu kan jag style med some new stuff i sommar när jag tränar/spelar :) Nu sitter jag och ska försöka beställa bikini från Victoria Secret, inte lätt det..

Tänkte jag skulle svara på lite frågor jag fått från läsare. Jag skriver bara era namn och sedan “svar” på frågan.

Svar till Frida: Klänningarna kommer super fort hem efter att man beställt dem, mina klänningar har kommit 1-2 dagar efter att jag beställt, sedan beror det på om de har klänningarna inne! Hoppas du blev nöjd med ditt svar :)

Svar till Emelie: Hej Emelie! Tack så mycket:)!! Jag tror att den största anledningen till att jag vann Miss World Sweden var den inre skönheten jag utspeglade i olika sorts perspektiv. Kram

Svar till Nita: Tusen tack fina Nita! Värmer att höra. Jag kommer alltid ha min titel som Miss World Sweden 2011 och det året 8e vackraste kvinnan i världen. Däremot kommer jag inte förbli “regerande” Miss World Sweden då jag snart kröner nästa tjej :) 

Vad tycker ni om att jag ska börja med bloppis? Jag har så grymt snygga designer kläder som jag bara använt en gång och sen kan jag inte ha det igen haha.  

Här kommer bild på mig och Karin från förra sommarn och bild på mina nya toppar :D

N

4 kommentarer

Nu har min balklänningen kommit, från luxdress.se :D

YEAHHHH!!!…

Hej B-B!! :D I morse gjorde jag prov i Engelska C, det var Cambridge prov så ganska svårt men jag hoppas det gick fint. Yeahh I am so happy för har precis fått min ALLDELES UNDERBART VACKRA BALKLÄNNING FRÅN WWW.LUXDRESS.SE :D Den är så grymt vacker men samtidigt sjukt sexig ;) Jag har införskaffat mig denna från luxdress.se, så har ni inte skaffat era bal- eller studentklänningar än så rekommenderar jag starkt att klicka in på deras hemsida där de har det allra nyaste från USA, så grymt snyggt!

Min balklänning tänker jag dock inte visa föräns på baldagen, så stay tuned ;)

N

3 kommentarer